Hydrogen peroxide-mediated killing of Caenorhabditis elegans by Streptococcus pyogenes.
نویسندگان
چکیده
Caenorhabditis elegans is currently introduced as a new, facile, and cheap model organism to study the pathogenesis of gram-negative bacteria such as Pseudomonas aeruginosa and Salmonella enterica serovar Typhimurium. The mechanisms of killing involve either diffusible exotoxins or infection-like processes. Recently, it was shown that also some gram-positive bacteria kill C. elegans, although the precise mechanisms of killing remained open. We examined C. elegans as a pathogenesis model for the gram-positive bacterium Streptococcus pyogenes, a major human pathogen capable of causing a wide spectrum of diseases. We demonstrate that S. pyogenes kills C. elegans, both on solid and in liquid medium. Unlike P. aeruginosa and S. enterica serovar Typhimurium, the killing by S. pyogenes is solely mediated by hydrogen peroxide. Killing required live streptococci; the killing capacity depends on the amount of hydrogen peroxide produced, and killing can be inhibited by catalase. Major exotoxins of S. pyogenes are not involved in the killing process as confirmed by using specific toxin inhibitors and knockout mutants. Moreover, no accumulation of S. pyogenes in C. elegans is observed, which excludes the involvement of infection-like processes. Preliminary results show that S. pneumoniae can also kill C. elegans by hydrogen peroxide production. Hydrogen peroxide-mediated killing might represent a common mechanism by which gram-positive, catalase-negative pathogens kill C. elegans.
منابع مشابه
Hydrogen peroxide-mediated killing of Caenorhabditis elegans: a common feature of different streptococcal species.
Recently, we reported that Streptococcus pyogenes kills Caenorhabditis elegans by the use of hydrogen peroxide (H2O2). Here we show that diverse streptococcal species cause death of C. elegans larvae in proportion to the level of H2O2 produced. H2O2 may mask the effects of other pathogenicity factors of catalase-negative bacteria in the C. elegans infection model.
متن کاملGenomes of Bacteria Living in Ants Deteriorated
The carotenoids that make carrots orange also produce the golden hue of Staphylococcus aureus. Such pigments appear to be a golden armor, shielding this pathogen from oxidants that mammalian neutrophils release, thus accounting for some of this microorganism’s virulence, according to Victor Nizet at the University of California, San Diego (USCD) and his collaborators. Perhaps these colorful vir...
متن کاملA simple model host for identifying Gram-positive virulence factors.
We demonstrate the use of the nematode Caenorhabditis elegans as a facile and inexpensive model host for several Gram-positive human bacterial pathogens. Enterococcus faecalis, Streptococcus pneumoniae, and Staphylococcus aureus, but not Bacillus subtilis, Enterococcus faecium, or Streptococcus pyogenes, kill adult C. elegans. Focusing our studies on the enterococcal species, we found that both...
متن کاملTocotrienol Modulates the Expression of Proteins in Oxidative Stress-Induced Caenorhabditis Elegans
Objective: Oxidative stress that damages proteins result in aging and age related diseases. The aim of this study is to determine the effect of tocotrienol rich fraction (TRF) on the expression of proteins in oxidative stress-induced caenohabditis elegans (C.elegans) which has homologous genes to humans. Methods: The worms were treated with TRF prior to, after and continuously in separate group...
متن کاملAllelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans
associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Infection and immunity
دوره 70 9 شماره
صفحات -
تاریخ انتشار 2002